ID: 1173030844

View in Genome Browser
Species Human (GRCh38)
Location 20:39358284-39358306
Sequence GGATGGGAAGTCCTGTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173030844_1173030854 13 Left 1173030844 20:39358284-39358306 CCCAACCACAGGACTTCCCATCC No data
Right 1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG No data
1173030844_1173030851 6 Left 1173030844 20:39358284-39358306 CCCAACCACAGGACTTCCCATCC No data
Right 1173030851 20:39358313-39358335 TGGAGAGTCTTACATGCAGAAGG No data
1173030844_1173030858 30 Left 1173030844 20:39358284-39358306 CCCAACCACAGGACTTCCCATCC No data
Right 1173030858 20:39358337-39358359 CCTGGGACTTTCCAAGTGTGGGG No data
1173030844_1173030856 29 Left 1173030844 20:39358284-39358306 CCCAACCACAGGACTTCCCATCC No data
Right 1173030856 20:39358336-39358358 GCCTGGGACTTTCCAAGTGTGGG No data
1173030844_1173030853 12 Left 1173030844 20:39358284-39358306 CCCAACCACAGGACTTCCCATCC No data
Right 1173030853 20:39358319-39358341 GTCTTACATGCAGAAGGGCCTGG No data
1173030844_1173030852 7 Left 1173030844 20:39358284-39358306 CCCAACCACAGGACTTCCCATCC No data
Right 1173030852 20:39358314-39358336 GGAGAGTCTTACATGCAGAAGGG No data
1173030844_1173030855 28 Left 1173030844 20:39358284-39358306 CCCAACCACAGGACTTCCCATCC No data
Right 1173030855 20:39358335-39358357 GGCCTGGGACTTTCCAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173030844 Original CRISPR GGATGGGAAGTCCTGTGGTT GGG (reversed) Intergenic
No off target data available for this crispr