ID: 1173030854

View in Genome Browser
Species Human (GRCh38)
Location 20:39358320-39358342
Sequence TCTTACATGCAGAAGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173030849_1173030854 -4 Left 1173030849 20:39358301-39358323 CCATCCTGCAGCTGGAGAGTCTT No data
Right 1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG No data
1173030844_1173030854 13 Left 1173030844 20:39358284-39358306 CCCAACCACAGGACTTCCCATCC No data
Right 1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG No data
1173030845_1173030854 12 Left 1173030845 20:39358285-39358307 CCAACCACAGGACTTCCCATCCT No data
Right 1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG No data
1173030846_1173030854 8 Left 1173030846 20:39358289-39358311 CCACAGGACTTCCCATCCTGCAG No data
Right 1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG No data
1173030848_1173030854 -3 Left 1173030848 20:39358300-39358322 CCCATCCTGCAGCTGGAGAGTCT No data
Right 1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG No data
1173030850_1173030854 -8 Left 1173030850 20:39358305-39358327 CCTGCAGCTGGAGAGTCTTACAT No data
Right 1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173030854 Original CRISPR TCTTACATGCAGAAGGGCCT GGG Intergenic
No off target data available for this crispr