ID: 1173033910

View in Genome Browser
Species Human (GRCh38)
Location 20:39390374-39390396
Sequence CTGCCTAAGCAGAAGCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173033910_1173033913 -8 Left 1173033910 20:39390374-39390396 CCAATCTGCTTCTGCTTAGGCAG No data
Right 1173033913 20:39390389-39390411 TTAGGCAGATGTCATGGGCCTGG No data
1173033910_1173033914 0 Left 1173033910 20:39390374-39390396 CCAATCTGCTTCTGCTTAGGCAG No data
Right 1173033914 20:39390397-39390419 ATGTCATGGGCCTGGATCAAAGG No data
1173033910_1173033915 4 Left 1173033910 20:39390374-39390396 CCAATCTGCTTCTGCTTAGGCAG No data
Right 1173033915 20:39390401-39390423 CATGGGCCTGGATCAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173033910 Original CRISPR CTGCCTAAGCAGAAGCAGAT TGG (reversed) Intergenic
No off target data available for this crispr