ID: 1173038465

View in Genome Browser
Species Human (GRCh38)
Location 20:39435692-39435714
Sequence ATGCTATCATTGAGGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173038465_1173038470 9 Left 1173038465 20:39435692-39435714 CCCAGTTTCCTCAATGATAGCAT No data
Right 1173038470 20:39435724-39435746 CTACAGTATAAATCACCATTGGG No data
1173038465_1173038469 8 Left 1173038465 20:39435692-39435714 CCCAGTTTCCTCAATGATAGCAT No data
Right 1173038469 20:39435723-39435745 ACTACAGTATAAATCACCATTGG No data
1173038465_1173038471 22 Left 1173038465 20:39435692-39435714 CCCAGTTTCCTCAATGATAGCAT No data
Right 1173038471 20:39435737-39435759 CACCATTGGGATATTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173038465 Original CRISPR ATGCTATCATTGAGGAAACT GGG (reversed) Intergenic
No off target data available for this crispr