ID: 1173041206

View in Genome Browser
Species Human (GRCh38)
Location 20:39464728-39464750
Sequence CTGTGGGTAGAGGGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173041206_1173041213 13 Left 1173041206 20:39464728-39464750 CCTTTTTTCCCCTCTACCCACAG No data
Right 1173041213 20:39464764-39464786 TTCTGTTGCCCAGCATCTGAAGG No data
1173041206_1173041215 15 Left 1173041206 20:39464728-39464750 CCTTTTTTCCCCTCTACCCACAG No data
Right 1173041215 20:39464766-39464788 CTGTTGCCCAGCATCTGAAGGGG No data
1173041206_1173041214 14 Left 1173041206 20:39464728-39464750 CCTTTTTTCCCCTCTACCCACAG No data
Right 1173041214 20:39464765-39464787 TCTGTTGCCCAGCATCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173041206 Original CRISPR CTGTGGGTAGAGGGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr