ID: 1173042589

View in Genome Browser
Species Human (GRCh38)
Location 20:39478352-39478374
Sequence TTGGACAATTTCGCCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173042582_1173042589 13 Left 1173042582 20:39478316-39478338 CCTGCTTTCAGGGCCCCATTATG No data
Right 1173042589 20:39478352-39478374 TTGGACAATTTCGCCTTTGTAGG No data
1173042581_1173042589 20 Left 1173042581 20:39478309-39478331 CCACAGGCCTGCTTTCAGGGCCC No data
Right 1173042589 20:39478352-39478374 TTGGACAATTTCGCCTTTGTAGG No data
1173042585_1173042589 -1 Left 1173042585 20:39478330-39478352 CCCATTATGATTTTAATGGACCT No data
Right 1173042589 20:39478352-39478374 TTGGACAATTTCGCCTTTGTAGG No data
1173042586_1173042589 -2 Left 1173042586 20:39478331-39478353 CCATTATGATTTTAATGGACCTT No data
Right 1173042589 20:39478352-39478374 TTGGACAATTTCGCCTTTGTAGG No data
1173042584_1173042589 0 Left 1173042584 20:39478329-39478351 CCCCATTATGATTTTAATGGACC No data
Right 1173042589 20:39478352-39478374 TTGGACAATTTCGCCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173042589 Original CRISPR TTGGACAATTTCGCCTTTGT AGG Intergenic
No off target data available for this crispr