ID: 1173044195

View in Genome Browser
Species Human (GRCh38)
Location 20:39493752-39493774
Sequence TGTTTGGTACAGATGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173044187_1173044195 12 Left 1173044187 20:39493717-39493739 CCCATGAGCAGCGGTGGTAGTAC No data
Right 1173044195 20:39493752-39493774 TGTTTGGTACAGATGGAGTATGG No data
1173044184_1173044195 18 Left 1173044184 20:39493711-39493733 CCCATTCCCATGAGCAGCGGTGG No data
Right 1173044195 20:39493752-39493774 TGTTTGGTACAGATGGAGTATGG No data
1173044188_1173044195 11 Left 1173044188 20:39493718-39493740 CCATGAGCAGCGGTGGTAGTACC No data
Right 1173044195 20:39493752-39493774 TGTTTGGTACAGATGGAGTATGG No data
1173044192_1173044195 -10 Left 1173044192 20:39493739-39493761 CCATGGGCCTTCATGTTTGGTAC No data
Right 1173044195 20:39493752-39493774 TGTTTGGTACAGATGGAGTATGG No data
1173044186_1173044195 17 Left 1173044186 20:39493712-39493734 CCATTCCCATGAGCAGCGGTGGT No data
Right 1173044195 20:39493752-39493774 TGTTTGGTACAGATGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173044195 Original CRISPR TGTTTGGTACAGATGGAGTA TGG Intergenic
No off target data available for this crispr