ID: 1173045147

View in Genome Browser
Species Human (GRCh38)
Location 20:39502700-39502722
Sequence GAAAGGCAGATGACACCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173045147_1173045154 -4 Left 1173045147 20:39502700-39502722 CCCTAAGGTGTCATCTGCCTTTC No data
Right 1173045154 20:39502719-39502741 TTTCAGGGGCACCAGGATCCTGG No data
1173045147_1173045158 18 Left 1173045147 20:39502700-39502722 CCCTAAGGTGTCATCTGCCTTTC No data
Right 1173045158 20:39502741-39502763 GTTCAGCCAGGACGAGCATCAGG No data
1173045147_1173045155 6 Left 1173045147 20:39502700-39502722 CCCTAAGGTGTCATCTGCCTTTC No data
Right 1173045155 20:39502729-39502751 ACCAGGATCCTGGTTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173045147 Original CRISPR GAAAGGCAGATGACACCTTA GGG (reversed) Intergenic
No off target data available for this crispr