ID: 1173045155

View in Genome Browser
Species Human (GRCh38)
Location 20:39502729-39502751
Sequence ACCAGGATCCTGGTTCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173045148_1173045155 5 Left 1173045148 20:39502701-39502723 CCTAAGGTGTCATCTGCCTTTCA No data
Right 1173045155 20:39502729-39502751 ACCAGGATCCTGGTTCAGCCAGG No data
1173045147_1173045155 6 Left 1173045147 20:39502700-39502722 CCCTAAGGTGTCATCTGCCTTTC No data
Right 1173045155 20:39502729-39502751 ACCAGGATCCTGGTTCAGCCAGG No data
1173045146_1173045155 7 Left 1173045146 20:39502699-39502721 CCCCTAAGGTGTCATCTGCCTTT No data
Right 1173045155 20:39502729-39502751 ACCAGGATCCTGGTTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173045155 Original CRISPR ACCAGGATCCTGGTTCAGCC AGG Intergenic
No off target data available for this crispr