ID: 1173045390

View in Genome Browser
Species Human (GRCh38)
Location 20:39504709-39504731
Sequence TTGAGCCAACAGACTTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173045386_1173045390 -5 Left 1173045386 20:39504691-39504713 CCATCTCTGCCTACTTCATTGAG No data
Right 1173045390 20:39504709-39504731 TTGAGCCAACAGACTTGGGTTGG No data
1173045384_1173045390 16 Left 1173045384 20:39504670-39504692 CCACTGAGAAGATCATCCTTACC No data
Right 1173045390 20:39504709-39504731 TTGAGCCAACAGACTTGGGTTGG No data
1173045385_1173045390 0 Left 1173045385 20:39504686-39504708 CCTTACCATCTCTGCCTACTTCA No data
Right 1173045390 20:39504709-39504731 TTGAGCCAACAGACTTGGGTTGG No data
1173045383_1173045390 28 Left 1173045383 20:39504658-39504680 CCTTAATTTTCTCCACTGAGAAG No data
Right 1173045390 20:39504709-39504731 TTGAGCCAACAGACTTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173045390 Original CRISPR TTGAGCCAACAGACTTGGGT TGG Intergenic
No off target data available for this crispr