ID: 1173047526

View in Genome Browser
Species Human (GRCh38)
Location 20:39526774-39526796
Sequence TTGGACTCTTTGAGAATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173047522_1173047526 -2 Left 1173047522 20:39526753-39526775 CCATAGGATTTGCCCTACAAATT No data
Right 1173047526 20:39526774-39526796 TTGGACTCTTTGAGAATAACAGG No data
1173047520_1173047526 19 Left 1173047520 20:39526732-39526754 CCATCTTCATAACTAGGGAAGCC No data
Right 1173047526 20:39526774-39526796 TTGGACTCTTTGAGAATAACAGG No data
1173047517_1173047526 28 Left 1173047517 20:39526723-39526745 CCATCATTGCCATCTTCATAACT No data
Right 1173047526 20:39526774-39526796 TTGGACTCTTTGAGAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173047526 Original CRISPR TTGGACTCTTTGAGAATAAC AGG Intergenic
No off target data available for this crispr