ID: 1173048523

View in Genome Browser
Species Human (GRCh38)
Location 20:39536341-39536363
Sequence CCTTTTGTGCAAAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173048516_1173048523 -2 Left 1173048516 20:39536320-39536342 CCTCACCCACTCAGGCTTAAGCC No data
Right 1173048523 20:39536341-39536363 CCTTTTGTGCAAAGGGAAGGTGG No data
1173048518_1173048523 -8 Left 1173048518 20:39536326-39536348 CCACTCAGGCTTAAGCCTTTTGT No data
Right 1173048523 20:39536341-39536363 CCTTTTGTGCAAAGGGAAGGTGG No data
1173048517_1173048523 -7 Left 1173048517 20:39536325-39536347 CCCACTCAGGCTTAAGCCTTTTG No data
Right 1173048523 20:39536341-39536363 CCTTTTGTGCAAAGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173048523 Original CRISPR CCTTTTGTGCAAAGGGAAGG TGG Intergenic
No off target data available for this crispr