ID: 1173049692

View in Genome Browser
Species Human (GRCh38)
Location 20:39547218-39547240
Sequence CCTTATAGATGGAGTCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173049692_1173049697 -4 Left 1173049692 20:39547218-39547240 CCAGCCAGACTCCATCTATAAGG No data
Right 1173049697 20:39547237-39547259 AAGGACTTGCAGAGTCAGGCAGG No data
1173049692_1173049696 -8 Left 1173049692 20:39547218-39547240 CCAGCCAGACTCCATCTATAAGG No data
Right 1173049696 20:39547233-39547255 CTATAAGGACTTGCAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173049692 Original CRISPR CCTTATAGATGGAGTCTGGC TGG (reversed) Intergenic
No off target data available for this crispr