ID: 1173051420

View in Genome Browser
Species Human (GRCh38)
Location 20:39565780-39565802
Sequence GCTTACCTCCAGCATGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173051418_1173051420 -4 Left 1173051418 20:39565761-39565783 CCACATATTTCCTGGGGCAGCTT No data
Right 1173051420 20:39565780-39565802 GCTTACCTCCAGCATGAGTGAGG No data
1173051413_1173051420 8 Left 1173051413 20:39565749-39565771 CCTCACCTAAGGCCACATATTTC No data
Right 1173051420 20:39565780-39565802 GCTTACCTCCAGCATGAGTGAGG No data
1173051415_1173051420 3 Left 1173051415 20:39565754-39565776 CCTAAGGCCACATATTTCCTGGG No data
Right 1173051420 20:39565780-39565802 GCTTACCTCCAGCATGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173051420 Original CRISPR GCTTACCTCCAGCATGAGTG AGG Intergenic
No off target data available for this crispr