ID: 1173057579

View in Genome Browser
Species Human (GRCh38)
Location 20:39630709-39630731
Sequence AAAGTTTCTCTCATTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173057579_1173057580 -5 Left 1173057579 20:39630709-39630731 CCAGAATCAATGAGAGAAACTTT No data
Right 1173057580 20:39630727-39630749 ACTTTTACAATTCAGATTTTTGG No data
1173057579_1173057581 -4 Left 1173057579 20:39630709-39630731 CCAGAATCAATGAGAGAAACTTT No data
Right 1173057581 20:39630728-39630750 CTTTTACAATTCAGATTTTTGGG No data
1173057579_1173057583 26 Left 1173057579 20:39630709-39630731 CCAGAATCAATGAGAGAAACTTT No data
Right 1173057583 20:39630758-39630780 TTGCCAAGTATTTTGATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173057579 Original CRISPR AAAGTTTCTCTCATTGATTC TGG (reversed) Intergenic
No off target data available for this crispr