ID: 1173057580

View in Genome Browser
Species Human (GRCh38)
Location 20:39630727-39630749
Sequence ACTTTTACAATTCAGATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173057577_1173057580 11 Left 1173057577 20:39630693-39630715 CCCAGATGGGCTGTGGCCAGAAT No data
Right 1173057580 20:39630727-39630749 ACTTTTACAATTCAGATTTTTGG No data
1173057579_1173057580 -5 Left 1173057579 20:39630709-39630731 CCAGAATCAATGAGAGAAACTTT No data
Right 1173057580 20:39630727-39630749 ACTTTTACAATTCAGATTTTTGG No data
1173057578_1173057580 10 Left 1173057578 20:39630694-39630716 CCAGATGGGCTGTGGCCAGAATC No data
Right 1173057580 20:39630727-39630749 ACTTTTACAATTCAGATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173057580 Original CRISPR ACTTTTACAATTCAGATTTT TGG Intergenic
No off target data available for this crispr