ID: 1173057583

View in Genome Browser
Species Human (GRCh38)
Location 20:39630758-39630780
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173057579_1173057583 26 Left 1173057579 20:39630709-39630731 CCAGAATCAATGAGAGAAACTTT No data
Right 1173057583 20:39630758-39630780 TTGCCAAGTATTTTGATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173057583 Original CRISPR TTGCCAAGTATTTTGATTTG TGG Intergenic
No off target data available for this crispr