ID: 1173058885

View in Genome Browser
Species Human (GRCh38)
Location 20:39642956-39642978
Sequence TGTCCAGAGATCCAAACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173058885_1173058887 2 Left 1173058885 20:39642956-39642978 CCTGGAGTTTGGATCTCTGGACA No data
Right 1173058887 20:39642981-39643003 TCCCCCTATCCCAACCAAATAGG No data
1173058885_1173058892 8 Left 1173058885 20:39642956-39642978 CCTGGAGTTTGGATCTCTGGACA No data
Right 1173058892 20:39642987-39643009 TATCCCAACCAAATAGGTTCTGG No data
1173058885_1173058893 9 Left 1173058885 20:39642956-39642978 CCTGGAGTTTGGATCTCTGGACA No data
Right 1173058893 20:39642988-39643010 ATCCCAACCAAATAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173058885 Original CRISPR TGTCCAGAGATCCAAACTCC AGG (reversed) Intergenic
No off target data available for this crispr