ID: 1173059618

View in Genome Browser
Species Human (GRCh38)
Location 20:39648747-39648769
Sequence TTGGAGATTCAGAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173059612_1173059618 -10 Left 1173059612 20:39648734-39648756 CCCAGAATGAGCATTGGAGATTC No data
Right 1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173059618 Original CRISPR TTGGAGATTCAGAATGGGGA GGG Intergenic
No off target data available for this crispr