ID: 1173059791

View in Genome Browser
Species Human (GRCh38)
Location 20:39650581-39650603
Sequence CTGGCTCTGTCCGCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173059783_1173059791 20 Left 1173059783 20:39650538-39650560 CCCATAACTGACTCTGTCTGCTG No data
Right 1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG No data
1173059787_1173059791 -5 Left 1173059787 20:39650563-39650585 CCTGGAGTCCTCCCATAACTGGC No data
Right 1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG No data
1173059784_1173059791 19 Left 1173059784 20:39650539-39650561 CCATAACTGACTCTGTCTGCTGT No data
Right 1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG No data
1173059782_1173059791 23 Left 1173059782 20:39650535-39650557 CCTCCCATAACTGACTCTGTCTG No data
Right 1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG No data
1173059781_1173059791 30 Left 1173059781 20:39650528-39650550 CCAGAGTCCTCCCATAACTGACT No data
Right 1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173059791 Original CRISPR CTGGCTCTGTCCGCTGTTCC TGG Intergenic
No off target data available for this crispr