ID: 1173062340

View in Genome Browser
Species Human (GRCh38)
Location 20:39674671-39674693
Sequence AACCCTTCAAAGCCAGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173062335_1173062340 14 Left 1173062335 20:39674634-39674656 CCATGGGCTTCTGCTCTGACCAT No data
Right 1173062340 20:39674671-39674693 AACCCTTCAAAGCCAGGATAAGG No data
1173062338_1173062340 -5 Left 1173062338 20:39674653-39674675 CCATTGGGAAAAGATCTGAACCC No data
Right 1173062340 20:39674671-39674693 AACCCTTCAAAGCCAGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173062340 Original CRISPR AACCCTTCAAAGCCAGGATA AGG Intergenic
No off target data available for this crispr