ID: 1173064201

View in Genome Browser
Species Human (GRCh38)
Location 20:39694223-39694245
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173064199_1173064201 -2 Left 1173064199 20:39694202-39694224 CCTTTTTAATTCTATTTAAGCCA No data
Right 1173064201 20:39694223-39694245 CAGAATTTCCTAAATTAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173064201 Original CRISPR CAGAATTTCCTAAATTAGCT CGG Intergenic
No off target data available for this crispr