ID: 1173068107

View in Genome Browser
Species Human (GRCh38)
Location 20:39734066-39734088
Sequence CCATAGTCTGCATTTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173068107_1173068110 11 Left 1173068107 20:39734066-39734088 CCACAAAGAAATGCAGACTATGG No data
Right 1173068110 20:39734100-39734122 AACTGTACTACAAAAGCAGGAGG No data
1173068107_1173068109 8 Left 1173068107 20:39734066-39734088 CCACAAAGAAATGCAGACTATGG No data
Right 1173068109 20:39734097-39734119 TCTAACTGTACTACAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173068107 Original CRISPR CCATAGTCTGCATTTCTTTG TGG (reversed) Intergenic
No off target data available for this crispr