ID: 1173069147

View in Genome Browser
Species Human (GRCh38)
Location 20:39744684-39744706
Sequence CAAGCTACACACCCTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173069142_1173069147 14 Left 1173069142 20:39744647-39744669 CCCAACGCTGTCATGGAGACCCA No data
Right 1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG No data
1173069145_1173069147 -6 Left 1173069145 20:39744667-39744689 CCAAATCACATTGATATCAAGCT No data
Right 1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG No data
1173069144_1173069147 -5 Left 1173069144 20:39744666-39744688 CCCAAATCACATTGATATCAAGC No data
Right 1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG No data
1173069143_1173069147 13 Left 1173069143 20:39744648-39744670 CCAACGCTGTCATGGAGACCCAA No data
Right 1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173069147 Original CRISPR CAAGCTACACACCCTGAAGT GGG Intergenic
No off target data available for this crispr