ID: 1173070158

View in Genome Browser
Species Human (GRCh38)
Location 20:39756457-39756479
Sequence TACAGGCCAAAGAGAGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173070155_1173070158 -8 Left 1173070155 20:39756442-39756464 CCAGAGGAAAACTTATACAGGCC No data
Right 1173070158 20:39756457-39756479 TACAGGCCAAAGAGAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173070158 Original CRISPR TACAGGCCAAAGAGAGCAAG GGG Intergenic
No off target data available for this crispr