ID: 1173071941

View in Genome Browser
Species Human (GRCh38)
Location 20:39776605-39776627
Sequence TAACCTTCTCCCCTTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173071940_1173071941 -2 Left 1173071940 20:39776584-39776606 CCTGGTATTCACGTCATTATGTA No data
Right 1173071941 20:39776605-39776627 TAACCTTCTCCCCTTGAGTGTGG No data
1173071938_1173071941 4 Left 1173071938 20:39776578-39776600 CCACCTCCTGGTATTCACGTCAT No data
Right 1173071941 20:39776605-39776627 TAACCTTCTCCCCTTGAGTGTGG No data
1173071936_1173071941 6 Left 1173071936 20:39776576-39776598 CCCCACCTCCTGGTATTCACGTC No data
Right 1173071941 20:39776605-39776627 TAACCTTCTCCCCTTGAGTGTGG No data
1173071937_1173071941 5 Left 1173071937 20:39776577-39776599 CCCACCTCCTGGTATTCACGTCA No data
Right 1173071941 20:39776605-39776627 TAACCTTCTCCCCTTGAGTGTGG No data
1173071939_1173071941 1 Left 1173071939 20:39776581-39776603 CCTCCTGGTATTCACGTCATTAT No data
Right 1173071941 20:39776605-39776627 TAACCTTCTCCCCTTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173071941 Original CRISPR TAACCTTCTCCCCTTGAGTG TGG Intergenic
No off target data available for this crispr