ID: 1173073271

View in Genome Browser
Species Human (GRCh38)
Location 20:39790885-39790907
Sequence CACTGTAAGGGCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173073263_1173073271 -10 Left 1173073263 20:39790872-39790894 CCTGTAATCCCAGCACTGTAAGG No data
Right 1173073271 20:39790885-39790907 CACTGTAAGGGCAAGGTGGGAGG No data
1173073262_1173073271 9 Left 1173073262 20:39790853-39790875 CCAGGTGTGGTGGCTCATGCCTG 0: 5377
1: 28995
2: 87460
3: 165025
4: 199163
Right 1173073271 20:39790885-39790907 CACTGTAAGGGCAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173073271 Original CRISPR CACTGTAAGGGCAAGGTGGG AGG Intergenic
No off target data available for this crispr