ID: 1173074853

View in Genome Browser
Species Human (GRCh38)
Location 20:39808025-39808047
Sequence CTGTAGGAAAGAGGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173074853_1173074863 12 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074863 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
1173074853_1173074868 21 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074868 20:39808069-39808091 AAGTGGTCAAGGGGGGCAGAAGG No data
1173074853_1173074865 14 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074865 20:39808062-39808084 TCTGCCCAAGTGGTCAAGGGGGG No data
1173074853_1173074869 28 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074869 20:39808076-39808098 CAAGGGGGGCAGAAGGCCCTAGG No data
1173074853_1173074859 4 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074859 20:39808052-39808074 CAAATTTTCCTCTGCCCAAGTGG No data
1173074853_1173074864 13 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074864 20:39808061-39808083 CTCTGCCCAAGTGGTCAAGGGGG No data
1173074853_1173074861 11 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074861 20:39808059-39808081 TCCTCTGCCCAAGTGGTCAAGGG No data
1173074853_1173074860 10 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074860 20:39808058-39808080 TTCCTCTGCCCAAGTGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173074853 Original CRISPR CTGTAGGAAAGAGGGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr