ID: 1173074858

View in Genome Browser
Species Human (GRCh38)
Location 20:39808041-39808063
Sequence GAGGAAAATTTGAATCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173074858_1173074874 22 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074874 20:39808086-39808108 AGAAGGCCCTAGGAGAAGGGGGG No data
1173074858_1173074868 5 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074868 20:39808069-39808091 AAGTGGTCAAGGGGGGCAGAAGG No data
1173074858_1173074870 18 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074870 20:39808082-39808104 GGGCAGAAGGCCCTAGGAGAAGG No data
1173074858_1173074865 -2 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074865 20:39808062-39808084 TCTGCCCAAGTGGTCAAGGGGGG No data
1173074858_1173074861 -5 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074861 20:39808059-39808081 TCCTCTGCCCAAGTGGTCAAGGG No data
1173074858_1173074863 -4 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074863 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
1173074858_1173074864 -3 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074864 20:39808061-39808083 CTCTGCCCAAGTGGTCAAGGGGG No data
1173074858_1173074871 19 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074871 20:39808083-39808105 GGCAGAAGGCCCTAGGAGAAGGG No data
1173074858_1173074860 -6 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074860 20:39808058-39808080 TTCCTCTGCCCAAGTGGTCAAGG No data
1173074858_1173074873 21 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074873 20:39808085-39808107 CAGAAGGCCCTAGGAGAAGGGGG No data
1173074858_1173074872 20 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074872 20:39808084-39808106 GCAGAAGGCCCTAGGAGAAGGGG No data
1173074858_1173074869 12 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074869 20:39808076-39808098 CAAGGGGGGCAGAAGGCCCTAGG No data
1173074858_1173074877 30 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074877 20:39808094-39808116 CTAGGAGAAGGGGGGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173074858 Original CRISPR GAGGAAAATTTGAATCCTGT AGG (reversed) Intergenic
No off target data available for this crispr