ID: 1173074859

View in Genome Browser
Species Human (GRCh38)
Location 20:39808052-39808074
Sequence CAAATTTTCCTCTGCCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173074853_1173074859 4 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074859 20:39808052-39808074 CAAATTTTCCTCTGCCCAAGTGG No data
1173074852_1173074859 27 Left 1173074852 20:39808002-39808024 CCTATTGCAACATTTTGTTATTT No data
Right 1173074859 20:39808052-39808074 CAAATTTTCCTCTGCCCAAGTGG No data
1173074857_1173074859 -5 Left 1173074857 20:39808034-39808056 CCTCTTTCCTACAGGATTCAAAT No data
Right 1173074859 20:39808052-39808074 CAAATTTTCCTCTGCCCAAGTGG No data
1173074856_1173074859 -4 Left 1173074856 20:39808033-39808055 CCCTCTTTCCTACAGGATTCAAA No data
Right 1173074859 20:39808052-39808074 CAAATTTTCCTCTGCCCAAGTGG No data
1173074855_1173074859 -3 Left 1173074855 20:39808032-39808054 CCCCTCTTTCCTACAGGATTCAA No data
Right 1173074859 20:39808052-39808074 CAAATTTTCCTCTGCCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173074859 Original CRISPR CAAATTTTCCTCTGCCCAAG TGG Intergenic
No off target data available for this crispr