ID: 1173074862

View in Genome Browser
Species Human (GRCh38)
Location 20:39808060-39808082
Sequence CCCCTTGACCACTTGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173074862_1173074869 -7 Left 1173074862 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
Right 1173074869 20:39808076-39808098 CAAGGGGGGCAGAAGGCCCTAGG No data
1173074862_1173074871 0 Left 1173074862 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
Right 1173074871 20:39808083-39808105 GGCAGAAGGCCCTAGGAGAAGGG No data
1173074862_1173074870 -1 Left 1173074862 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
Right 1173074870 20:39808082-39808104 GGGCAGAAGGCCCTAGGAGAAGG No data
1173074862_1173074878 29 Left 1173074862 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
Right 1173074878 20:39808112-39808134 TGAGGCACGCATTACTCCTGAGG No data
1173074862_1173074874 3 Left 1173074862 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
Right 1173074874 20:39808086-39808108 AGAAGGCCCTAGGAGAAGGGGGG No data
1173074862_1173074873 2 Left 1173074862 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
Right 1173074873 20:39808085-39808107 CAGAAGGCCCTAGGAGAAGGGGG No data
1173074862_1173074877 11 Left 1173074862 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
Right 1173074877 20:39808094-39808116 CTAGGAGAAGGGGGGCAGTGAGG No data
1173074862_1173074872 1 Left 1173074862 20:39808060-39808082 CCTCTGCCCAAGTGGTCAAGGGG No data
Right 1173074872 20:39808084-39808106 GCAGAAGGCCCTAGGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173074862 Original CRISPR CCCCTTGACCACTTGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr