ID: 1173074865

View in Genome Browser
Species Human (GRCh38)
Location 20:39808062-39808084
Sequence TCTGCCCAAGTGGTCAAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173074856_1173074865 6 Left 1173074856 20:39808033-39808055 CCCTCTTTCCTACAGGATTCAAA No data
Right 1173074865 20:39808062-39808084 TCTGCCCAAGTGGTCAAGGGGGG No data
1173074855_1173074865 7 Left 1173074855 20:39808032-39808054 CCCCTCTTTCCTACAGGATTCAA No data
Right 1173074865 20:39808062-39808084 TCTGCCCAAGTGGTCAAGGGGGG No data
1173074858_1173074865 -2 Left 1173074858 20:39808041-39808063 CCTACAGGATTCAAATTTTCCTC No data
Right 1173074865 20:39808062-39808084 TCTGCCCAAGTGGTCAAGGGGGG No data
1173074853_1173074865 14 Left 1173074853 20:39808025-39808047 CCATTTTCCCCTCTTTCCTACAG No data
Right 1173074865 20:39808062-39808084 TCTGCCCAAGTGGTCAAGGGGGG No data
1173074857_1173074865 5 Left 1173074857 20:39808034-39808056 CCTCTTTCCTACAGGATTCAAAT No data
Right 1173074865 20:39808062-39808084 TCTGCCCAAGTGGTCAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173074865 Original CRISPR TCTGCCCAAGTGGTCAAGGG GGG Intergenic
No off target data available for this crispr