ID: 1173075577

View in Genome Browser
Species Human (GRCh38)
Location 20:39815868-39815890
Sequence GAGTTGGTGTGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173075577_1173075585 26 Left 1173075577 20:39815868-39815890 CCTTCTTCCCTCCACACCAACTC No data
Right 1173075585 20:39815917-39815939 CCTATTCATCCTGCTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173075577 Original CRISPR GAGTTGGTGTGGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr