ID: 1173075585

View in Genome Browser
Species Human (GRCh38)
Location 20:39815917-39815939
Sequence CCTATTCATCCTGCTTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173075577_1173075585 26 Left 1173075577 20:39815868-39815890 CCTTCTTCCCTCCACACCAACTC No data
Right 1173075585 20:39815917-39815939 CCTATTCATCCTGCTTCAGTTGG No data
1173075581_1173075585 10 Left 1173075581 20:39815884-39815906 CCAACTCACTCCATCATCTTCAA No data
Right 1173075585 20:39815917-39815939 CCTATTCATCCTGCTTCAGTTGG No data
1173075579_1173075585 18 Left 1173075579 20:39815876-39815898 CCTCCACACCAACTCACTCCATC No data
Right 1173075585 20:39815917-39815939 CCTATTCATCCTGCTTCAGTTGG No data
1173075580_1173075585 15 Left 1173075580 20:39815879-39815901 CCACACCAACTCACTCCATCATC No data
Right 1173075585 20:39815917-39815939 CCTATTCATCCTGCTTCAGTTGG No data
1173075582_1173075585 0 Left 1173075582 20:39815894-39815916 CCATCATCTTCAACAACTGCCAA No data
Right 1173075585 20:39815917-39815939 CCTATTCATCCTGCTTCAGTTGG No data
1173075578_1173075585 19 Left 1173075578 20:39815875-39815897 CCCTCCACACCAACTCACTCCAT No data
Right 1173075585 20:39815917-39815939 CCTATTCATCCTGCTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173075585 Original CRISPR CCTATTCATCCTGCTTCAGT TGG Intergenic
No off target data available for this crispr