ID: 1173078825

View in Genome Browser
Species Human (GRCh38)
Location 20:39846641-39846663
Sequence TATTCAGAAAGCTGTATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173078825_1173078832 14 Left 1173078825 20:39846641-39846663 CCTTCCATACAGCTTTCTGAATA No data
Right 1173078832 20:39846678-39846700 TCCCTCTGCTCCCAATGCCCTGG No data
1173078825_1173078837 25 Left 1173078825 20:39846641-39846663 CCTTCCATACAGCTTTCTGAATA No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173078825 Original CRISPR TATTCAGAAAGCTGTATGGA AGG (reversed) Intergenic
No off target data available for this crispr