ID: 1173078826

View in Genome Browser
Species Human (GRCh38)
Location 20:39846645-39846667
Sequence GGGATATTCAGAAAGCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173078826_1173078832 10 Left 1173078826 20:39846645-39846667 CCATACAGCTTTCTGAATATCCC No data
Right 1173078832 20:39846678-39846700 TCCCTCTGCTCCCAATGCCCTGG No data
1173078826_1173078837 21 Left 1173078826 20:39846645-39846667 CCATACAGCTTTCTGAATATCCC No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173078826 Original CRISPR GGGATATTCAGAAAGCTGTA TGG (reversed) Intergenic
No off target data available for this crispr