ID: 1173078827

View in Genome Browser
Species Human (GRCh38)
Location 20:39846665-39846687
Sequence AGCAGAGGGAGAAAGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173078827_1173078841 22 Left 1173078827 20:39846665-39846687 CCCCCAGCCTTTCTCCCTCTGCT No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078827_1173078840 16 Left 1173078827 20:39846665-39846687 CCCCCAGCCTTTCTCCCTCTGCT No data
Right 1173078840 20:39846704-39846726 AGATGTGGCCTTATTATCTCTGG No data
1173078827_1173078843 28 Left 1173078827 20:39846665-39846687 CCCCCAGCCTTTCTCCCTCTGCT No data
Right 1173078843 20:39846716-39846738 ATTATCTCTGGAATAGGTTAAGG No data
1173078827_1173078837 1 Left 1173078827 20:39846665-39846687 CCCCCAGCCTTTCTCCCTCTGCT No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
1173078827_1173078832 -10 Left 1173078827 20:39846665-39846687 CCCCCAGCCTTTCTCCCTCTGCT No data
Right 1173078832 20:39846678-39846700 TCCCTCTGCTCCCAATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173078827 Original CRISPR AGCAGAGGGAGAAAGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr