ID: 1173078828

View in Genome Browser
Species Human (GRCh38)
Location 20:39846666-39846688
Sequence GAGCAGAGGGAGAAAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173078828_1173078841 21 Left 1173078828 20:39846666-39846688 CCCCAGCCTTTCTCCCTCTGCTC No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078828_1173078837 0 Left 1173078828 20:39846666-39846688 CCCCAGCCTTTCTCCCTCTGCTC No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
1173078828_1173078840 15 Left 1173078828 20:39846666-39846688 CCCCAGCCTTTCTCCCTCTGCTC No data
Right 1173078840 20:39846704-39846726 AGATGTGGCCTTATTATCTCTGG No data
1173078828_1173078843 27 Left 1173078828 20:39846666-39846688 CCCCAGCCTTTCTCCCTCTGCTC No data
Right 1173078843 20:39846716-39846738 ATTATCTCTGGAATAGGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173078828 Original CRISPR GAGCAGAGGGAGAAAGGCTG GGG (reversed) Intergenic
No off target data available for this crispr