ID: 1173078837

View in Genome Browser
Species Human (GRCh38)
Location 20:39846689-39846711
Sequence CCAATGCCCTGGTGAAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173078825_1173078837 25 Left 1173078825 20:39846641-39846663 CCTTCCATACAGCTTTCTGAATA No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
1173078827_1173078837 1 Left 1173078827 20:39846665-39846687 CCCCCAGCCTTTCTCCCTCTGCT No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
1173078826_1173078837 21 Left 1173078826 20:39846645-39846667 CCATACAGCTTTCTGAATATCCC No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
1173078829_1173078837 -1 Left 1173078829 20:39846667-39846689 CCCAGCCTTTCTCCCTCTGCTCC No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
1173078831_1173078837 -6 Left 1173078831 20:39846672-39846694 CCTTTCTCCCTCTGCTCCCAATG No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
1173078830_1173078837 -2 Left 1173078830 20:39846668-39846690 CCAGCCTTTCTCCCTCTGCTCCC No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
1173078828_1173078837 0 Left 1173078828 20:39846666-39846688 CCCCAGCCTTTCTCCCTCTGCTC No data
Right 1173078837 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173078837 Original CRISPR CCAATGCCCTGGTGAAGATG TGG Intergenic
No off target data available for this crispr