ID: 1173078839

View in Genome Browser
Species Human (GRCh38)
Location 20:39846696-39846718
Sequence AATAAGGCCACATCTTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173078839_1173078843 -3 Left 1173078839 20:39846696-39846718 CCTGGTGAAGATGTGGCCTTATT No data
Right 1173078843 20:39846716-39846738 ATTATCTCTGGAATAGGTTAAGG No data
1173078839_1173078841 -9 Left 1173078839 20:39846696-39846718 CCTGGTGAAGATGTGGCCTTATT No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173078839 Original CRISPR AATAAGGCCACATCTTCACC AGG (reversed) Intergenic
No off target data available for this crispr