ID: 1173078841

View in Genome Browser
Species Human (GRCh38)
Location 20:39846710-39846732
Sequence GGCCTTATTATCTCTGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173078835_1173078841 -1 Left 1173078835 20:39846688-39846710 CCCAATGCCCTGGTGAAGATGTG No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078831_1173078841 15 Left 1173078831 20:39846672-39846694 CCTTTCTCCCTCTGCTCCCAATG No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078839_1173078841 -9 Left 1173078839 20:39846696-39846718 CCTGGTGAAGATGTGGCCTTATT No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078828_1173078841 21 Left 1173078828 20:39846666-39846688 CCCCAGCCTTTCTCCCTCTGCTC No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078830_1173078841 19 Left 1173078830 20:39846668-39846690 CCAGCCTTTCTCCCTCTGCTCCC No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078833_1173078841 8 Left 1173078833 20:39846679-39846701 CCCTCTGCTCCCAATGCCCTGGT No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078834_1173078841 7 Left 1173078834 20:39846680-39846702 CCTCTGCTCCCAATGCCCTGGTG No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078836_1173078841 -2 Left 1173078836 20:39846689-39846711 CCAATGCCCTGGTGAAGATGTGG No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078838_1173078841 -8 Left 1173078838 20:39846695-39846717 CCCTGGTGAAGATGTGGCCTTAT No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078827_1173078841 22 Left 1173078827 20:39846665-39846687 CCCCCAGCCTTTCTCCCTCTGCT No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data
1173078829_1173078841 20 Left 1173078829 20:39846667-39846689 CCCAGCCTTTCTCCCTCTGCTCC No data
Right 1173078841 20:39846710-39846732 GGCCTTATTATCTCTGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173078841 Original CRISPR GGCCTTATTATCTCTGGAAT AGG Intergenic
No off target data available for this crispr