ID: 1173079774

View in Genome Browser
Species Human (GRCh38)
Location 20:39854605-39854627
Sequence TCAGACTGTAGAATTACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173079774_1173079778 18 Left 1173079774 20:39854605-39854627 CCCTTGGTAATTCTACAGTCTGA No data
Right 1173079778 20:39854646-39854668 CTTAGAGACTTCATATTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173079774 Original CRISPR TCAGACTGTAGAATTACCAA GGG (reversed) Intergenic
No off target data available for this crispr