ID: 1173088042

View in Genome Browser
Species Human (GRCh38)
Location 20:39943281-39943303
Sequence GTGGAGAGCTGGCCTGCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173088039_1173088042 15 Left 1173088039 20:39943243-39943265 CCTCAGCATTATCATTTGGGGAT No data
Right 1173088042 20:39943281-39943303 GTGGAGAGCTGGCCTGCGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173088042 Original CRISPR GTGGAGAGCTGGCCTGCGCA CGG Intergenic
No off target data available for this crispr