ID: 1173091568

View in Genome Browser
Species Human (GRCh38)
Location 20:39976961-39976983
Sequence CTTGTTCAGAAAATATTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173091568_1173091575 18 Left 1173091568 20:39976961-39976983 CCAACAAATATTTTCTGAACAAG No data
Right 1173091575 20:39977002-39977024 CTAGGATTAAGAGATATTAATGG No data
1173091568_1173091571 -5 Left 1173091568 20:39976961-39976983 CCAACAAATATTTTCTGAACAAG No data
Right 1173091571 20:39976979-39977001 ACAAGCTGGGTGCCCAGTCATGG No data
1173091568_1173091572 0 Left 1173091568 20:39976961-39976983 CCAACAAATATTTTCTGAACAAG No data
Right 1173091572 20:39976984-39977006 CTGGGTGCCCAGTCATGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173091568 Original CRISPR CTTGTTCAGAAAATATTTGT TGG (reversed) Intergenic
No off target data available for this crispr