ID: 1173094988

View in Genome Browser
Species Human (GRCh38)
Location 20:40017533-40017555
Sequence ATCATCTACGAGGAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173094988_1173094993 27 Left 1173094988 20:40017533-40017555 CCATCCATTTCCTCGTAGATGAT No data
Right 1173094993 20:40017583-40017605 CACATTACACAAGATTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173094988 Original CRISPR ATCATCTACGAGGAAATGGA TGG (reversed) Intergenic
No off target data available for this crispr