ID: 1173096141

View in Genome Browser
Species Human (GRCh38)
Location 20:40030399-40030421
Sequence TAGATACCATGTTAGATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173096141_1173096144 21 Left 1173096141 20:40030399-40030421 CCCAACATCTAACATGGTATCTA No data
Right 1173096144 20:40030443-40030465 GTGCTTGTTGACCTGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173096141 Original CRISPR TAGATACCATGTTAGATGTT GGG (reversed) Intergenic
No off target data available for this crispr