ID: 1173096893

View in Genome Browser
Species Human (GRCh38)
Location 20:40041980-40042002
Sequence GTACAGTTCTTGGCATAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173096890_1173096893 5 Left 1173096890 20:40041952-40041974 CCATTTTCTTATGCATTTGACCA No data
Right 1173096893 20:40041980-40042002 GTACAGTTCTTGGCATAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173096893 Original CRISPR GTACAGTTCTTGGCATAACC TGG Intergenic
No off target data available for this crispr