ID: 1173104737

View in Genome Browser
Species Human (GRCh38)
Location 20:40123242-40123264
Sequence TGCCACCATGAAGTTTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173104737_1173104742 4 Left 1173104737 20:40123242-40123264 CCCCATCAAACTTCATGGTGGCA No data
Right 1173104742 20:40123269-40123291 CATGTCCAATCCACTCTCCCAGG No data
1173104737_1173104743 5 Left 1173104737 20:40123242-40123264 CCCCATCAAACTTCATGGTGGCA No data
Right 1173104743 20:40123270-40123292 ATGTCCAATCCACTCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173104737 Original CRISPR TGCCACCATGAAGTTTGATG GGG (reversed) Intergenic
No off target data available for this crispr