ID: 1173105628

View in Genome Browser
Species Human (GRCh38)
Location 20:40130932-40130954
Sequence TCACATCGATGGTGACCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173105624_1173105628 17 Left 1173105624 20:40130892-40130914 CCTAGAAGCTCAGAGTAAGATCT No data
Right 1173105628 20:40130932-40130954 TCACATCGATGGTGACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173105628 Original CRISPR TCACATCGATGGTGACCTGA GGG Intergenic
No off target data available for this crispr