ID: 1173107714

View in Genome Browser
Species Human (GRCh38)
Location 20:40153353-40153375
Sequence CTTTAAGTGATCCTAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173107714_1173107719 18 Left 1173107714 20:40153353-40153375 CCTTCCTCTAGGATCACTTAAAG No data
Right 1173107719 20:40153394-40153416 CTGACCACAGTGTCCTTGGGTGG No data
1173107714_1173107717 14 Left 1173107714 20:40153353-40153375 CCTTCCTCTAGGATCACTTAAAG No data
Right 1173107717 20:40153390-40153412 TGAGCTGACCACAGTGTCCTTGG No data
1173107714_1173107721 27 Left 1173107714 20:40153353-40153375 CCTTCCTCTAGGATCACTTAAAG No data
Right 1173107721 20:40153403-40153425 GTGTCCTTGGGTGGAAAGAATGG No data
1173107714_1173107718 15 Left 1173107714 20:40153353-40153375 CCTTCCTCTAGGATCACTTAAAG No data
Right 1173107718 20:40153391-40153413 GAGCTGACCACAGTGTCCTTGGG 0: 1
1: 0
2: 0
3: 17
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173107714 Original CRISPR CTTTAAGTGATCCTAGAGGA AGG (reversed) Intergenic